ID: 1137883072_1137883075

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1137883072 1137883075
Species Human (GRCh38) Human (GRCh38)
Location 16:52072844-52072866 16:52072873-52072895
Sequence CCTGGTAGTGGTTGTCCTGGGTA AGATTAGTGTCCACATAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90} {0: 1, 1: 1, 2: 8, 3: 118, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!