ID: 1137976771_1137976776

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1137976771 1137976776
Species Human (GRCh38) Human (GRCh38)
Location 16:53038689-53038711 16:53038709-53038731
Sequence CCCTGTACAACAACGGGGTTTTA TTATTGTAGGGGAGAGAGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 57, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!