ID: 1137983195_1137983200

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1137983195 1137983200
Species Human (GRCh38) Human (GRCh38)
Location 16:53086965-53086987 16:53086985-53087007
Sequence CCCTTCCAGGGGGCCACACCTCC TCCTATCCCCACCATGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 251} {0: 1, 1: 0, 2: 1, 3: 27, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!