ID: 1137985205_1137985208

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1137985205 1137985208
Species Human (GRCh38) Human (GRCh38)
Location 16:53101482-53101504 16:53101511-53101533
Sequence CCAGGCCGACAATTTTTTAATCA AAACTTATGAAGTTACTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 511} {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!