ID: 1138010837_1138010847

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1138010837 1138010847
Species Human (GRCh38) Human (GRCh38)
Location 16:53378394-53378416 16:53378437-53378459
Sequence CCTTTTAAGGTAGGTCAGTGGGG AGGGCGGCTAATGGGCCCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!