ID: 1138041885_1138041889

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1138041885 1138041889
Species Human (GRCh38) Human (GRCh38)
Location 16:53680349-53680371 16:53680362-53680384
Sequence CCATCAGAGAACCAGATGTGCCC AGATGTGCCCTTTAAATTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 158} {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!