ID: 1138064281_1138064292

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1138064281 1138064292
Species Human (GRCh38) Human (GRCh38)
Location 16:53924552-53924574 16:53924595-53924617
Sequence CCTTTCAAGACAGTGGAGTTTAT TAGACTATGAAGGGCGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 162} {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!