ID: 1138064284_1138064292

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1138064284 1138064292
Species Human (GRCh38) Human (GRCh38)
Location 16:53924577-53924599 16:53924595-53924617
Sequence CCTGCTTTCCTGGGTGAGTAGAC TAGACTATGAAGGGCGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 122} {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!