|
Left Crispr |
Right Crispr |
| Crispr ID |
1138066958 |
1138066964 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:53952171-53952193
|
16:53952219-53952241
|
| Sequence |
CCCAGAGAGGTTAGGGAATTTAC |
TCAAGCCAGGATTTGAGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 13, 3: 108, 4: 576} |
{0: 1, 1: 7, 2: 34, 3: 231, 4: 1022} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|