ID: 1138069070_1138069073

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1138069070 1138069073
Species Human (GRCh38) Human (GRCh38)
Location 16:53972684-53972706 16:53972711-53972733
Sequence CCCAGAGGCTGTGCATACTGCCT TTCAATCAGCTCTACATTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 246} {0: 1, 1: 0, 2: 1, 3: 21, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!