ID: 1138078359_1138078369

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1138078359 1138078369
Species Human (GRCh38) Human (GRCh38)
Location 16:54065014-54065036 16:54065054-54065076
Sequence CCCGCCTGACTCTGGTCACAATG AGGCACGTACCACTGAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 183} {0: 1, 1: 0, 2: 2, 3: 8, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!