ID: 1138083378_1138083385

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1138083378 1138083385
Species Human (GRCh38) Human (GRCh38)
Location 16:54112981-54113003 16:54113031-54113053
Sequence CCTTTGGCATGTTAACGTGCCTC TATGAAAGGCACCAGTCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 59} {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!