ID: 1138122730_1138122733

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1138122730 1138122733
Species Human (GRCh38) Human (GRCh38)
Location 16:54413522-54413544 16:54413545-54413567
Sequence CCCTACAGGATCCAGCATGCATC TTGTACATCGTCAGCCATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!