ID: 1138139214_1138139222

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1138139214 1138139222
Species Human (GRCh38) Human (GRCh38)
Location 16:54552884-54552906 16:54552902-54552924
Sequence CCCCAGCCCAGGGAGTTAAGATC AGATCTCAGCCCTGGGGAGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!