ID: 1138173078_1138173086

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1138173078 1138173086
Species Human (GRCh38) Human (GRCh38)
Location 16:54871268-54871290 16:54871319-54871341
Sequence CCGGATCTCCCGATAATTCACTC TGGTGCTAAACCATTCATGAAGG
Strand - +
Off-target summary No data {0: 113, 1: 307, 2: 448, 3: 495, 4: 1008}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!