ID: 1138175638_1138175639

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1138175638 1138175639
Species Human (GRCh38) Human (GRCh38)
Location 16:54895902-54895924 16:54895916-54895938
Sequence CCAAAGAAGTGGACATGTTTGCC ATGTTTGCCTTTAATGTCTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 113} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!