ID: 1138178718_1138178731

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1138178718 1138178731
Species Human (GRCh38) Human (GRCh38)
Location 16:54928827-54928849 16:54928866-54928888
Sequence CCCCCGGCGGGCGGCGCGCGCGG AGCGCCAGGGGCTGCGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 273} {0: 1, 1: 1, 2: 3, 3: 69, 4: 1004}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!