ID: 1138230242_1138230257

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1138230242 1138230257
Species Human (GRCh38) Human (GRCh38)
Location 16:55331216-55331238 16:55331268-55331290
Sequence CCAACCAATGGGAACTGACGGGC GAGTGTCGAGCGACCGGGTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!