ID: 1138244987_1138244992

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1138244987 1138244992
Species Human (GRCh38) Human (GRCh38)
Location 16:55460720-55460742 16:55460765-55460787
Sequence CCGCAGGGAGAAAGAGCTGAGTG AGCCCCGCCGCTGGCCTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 355} {0: 1, 1: 0, 2: 0, 3: 19, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!