ID: 1138251189_1138251200

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1138251189 1138251200
Species Human (GRCh38) Human (GRCh38)
Location 16:55503053-55503075 16:55503102-55503124
Sequence CCTGACCTCTGCTCCTTGGCCTG CTTCTCACAGCTGCAGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 431} {0: 1, 1: 0, 2: 5, 3: 58, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!