|
Left Crispr |
Right Crispr |
| Crispr ID |
1138271141 |
1138271151 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:55696702-55696724
|
16:55696736-55696758
|
| Sequence |
CCAGGCATGGTGGCTCACTCCTA |
CTGTGGAAGGCTGAGGTGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 43, 1: 1962, 2: 21178, 3: 73114, 4: 155346} |
{0: 3, 1: 79, 2: 2744, 3: 32920, 4: 94385} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|