ID: 1138286414_1138286418

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1138286414 1138286418
Species Human (GRCh38) Human (GRCh38)
Location 16:55813603-55813625 16:55813643-55813665
Sequence CCAATTTCCTTCTCCTTTTTCTG ATTTTTCAACACCAAATGCACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 12, 3: 169, 4: 1612} {0: 2, 1: 0, 2: 0, 3: 21, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!