ID: 1138297383_1138297394

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1138297383 1138297394
Species Human (GRCh38) Human (GRCh38)
Location 16:55898738-55898760 16:55898784-55898806
Sequence CCAGCACCATGGGAGAGGCTGAG CCAGGAAGACCAGGGCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 65, 4: 484} {0: 1, 1: 0, 2: 3, 3: 66, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!