ID: 1138330486_1138330493

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1138330486 1138330493
Species Human (GRCh38) Human (GRCh38)
Location 16:56211397-56211419 16:56211421-56211443
Sequence CCCAGAACTCCCTGGGCCTCCTA CTCCAGCTATGCCGTCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 249} {0: 1, 1: 0, 2: 3, 3: 23, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!