ID: 1138330486_1138330502

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1138330486 1138330502
Species Human (GRCh38) Human (GRCh38)
Location 16:56211397-56211419 16:56211446-56211468
Sequence CCCAGAACTCCCTGGGCCTCCTA CCCCTCCCAGCCCAGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 249} {0: 1, 1: 0, 2: 11, 3: 112, 4: 760}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!