ID: 1138349067_1138349081

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1138349067 1138349081
Species Human (GRCh38) Human (GRCh38)
Location 16:56336876-56336898 16:56336924-56336946
Sequence CCCCCGGGCAGGGGGCAGCGCTG CCCTCTGAGCACTGGGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 381} {0: 1, 1: 0, 2: 5, 3: 35, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!