ID: 1138360759_1138360769

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1138360759 1138360769
Species Human (GRCh38) Human (GRCh38)
Location 16:56425460-56425482 16:56425506-56425528
Sequence CCGGGCCGGGCCGCTCCTGGCTG GCTCCCGCTGCTGCCCCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 539} {0: 1, 1: 1, 2: 10, 3: 94, 4: 915}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!