ID: 1138360778_1138360800

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1138360778 1138360800
Species Human (GRCh38) Human (GRCh38)
Location 16:56425525-56425547 16:56425578-56425600
Sequence CCGGCGCGGAAGAGCCTGGGCGG CGCTGGCGGGACGGGCGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111} {0: 1, 1: 0, 2: 3, 3: 24, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!