ID: 1138394809_1138394822

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1138394809 1138394822
Species Human (GRCh38) Human (GRCh38)
Location 16:56695694-56695716 16:56695746-56695768
Sequence CCATGGGCCAATCGGTGTGCCCT GACCGAGCTGAGCAGACTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 120} {0: 1, 1: 0, 2: 0, 3: 11, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!