ID: 1138410571_1138410573

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1138410571 1138410573
Species Human (GRCh38) Human (GRCh38)
Location 16:56836481-56836503 16:56836494-56836516
Sequence CCCAGGGCAAGCAATTCCACTTG ATTCCACTTGAAGTATTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 166} {0: 1, 1: 0, 2: 4, 3: 26, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!