ID: 1138415096_1138415105

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1138415096 1138415105
Species Human (GRCh38) Human (GRCh38)
Location 16:56867108-56867130 16:56867124-56867146
Sequence CCGGCCCAGCCACGAGATGACTG ATGACTGATGGGCTGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 176} {0: 1, 1: 0, 2: 0, 3: 27, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!