ID: 1138418044_1138418060

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1138418044 1138418060
Species Human (GRCh38) Human (GRCh38)
Location 16:56882514-56882536 16:56882541-56882563
Sequence CCCACCTCAGGAGGAGGCACCCA GCAGGAGGAACTGGGGCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 213} {0: 1, 1: 0, 2: 10, 3: 50, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!