ID: 1138418044_1138418061

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1138418044 1138418061
Species Human (GRCh38) Human (GRCh38)
Location 16:56882514-56882536 16:56882544-56882566
Sequence CCCACCTCAGGAGGAGGCACCCA GGAGGAACTGGGGCATGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 213} {0: 1, 1: 1, 2: 14, 3: 124, 4: 1020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!