ID: 1138423542_1138423553

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1138423542 1138423553
Species Human (GRCh38) Human (GRCh38)
Location 16:56915408-56915430 16:56915456-56915478
Sequence CCAGAAGGCTTGGGGCTCCCAGG CGCCTCAGGGCTTGCTACGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 271} {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!