ID: 1138423554_1138423563

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1138423554 1138423563
Species Human (GRCh38) Human (GRCh38)
Location 16:56915458-56915480 16:56915511-56915533
Sequence CCTCAGGGCTTGCTACGAGGGAC TCTCGTGCTCCTGAGGGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56} {0: 1, 1: 0, 2: 0, 3: 13, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!