ID: 1138443759_1138443772

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1138443759 1138443772
Species Human (GRCh38) Human (GRCh38)
Location 16:57050446-57050468 16:57050491-57050513
Sequence CCCTTGGAGGCCCCGGAGAGGGG AAGGAACAGAAAGAGAGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 192} {0: 1, 1: 5, 2: 41, 3: 512, 4: 3929}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!