ID: 1138445691_1138445709

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1138445691 1138445709
Species Human (GRCh38) Human (GRCh38)
Location 16:57061708-57061730 16:57061738-57061760
Sequence CCTCCCCCGCTGCCTCCGGGAGG GCATGAATGGGAGCAGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 480} {0: 1, 1: 0, 2: 4, 3: 47, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!