ID: 1138448456_1138448470

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1138448456 1138448470
Species Human (GRCh38) Human (GRCh38)
Location 16:57079024-57079046 16:57079059-57079081
Sequence CCTCTCACCCTCTCCTCTTTCCC CAGCCATCTGGGCCCAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 31, 3: 297, 4: 2275} {0: 1, 1: 0, 2: 1, 3: 34, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!