ID: 1138454926_1138454930

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1138454926 1138454930
Species Human (GRCh38) Human (GRCh38)
Location 16:57115712-57115734 16:57115727-57115749
Sequence CCACAAATGATGCAGTGGGGGCT TGGGGGCTGACAAGCTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124} {0: 1, 1: 2, 2: 7, 3: 47, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!