ID: 1138474947_1138474955

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1138474947 1138474955
Species Human (GRCh38) Human (GRCh38)
Location 16:57265090-57265112 16:57265124-57265146
Sequence CCTGCCAGCCTCTGCTGCCCGTC CGCCGCAAGCAGGCCAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 414} {0: 1, 1: 0, 2: 0, 3: 12, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!