ID: 1138488397_1138488403

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1138488397 1138488403
Species Human (GRCh38) Human (GRCh38)
Location 16:57361449-57361471 16:57361483-57361505
Sequence CCTACGAGGAAGTTCAACGATTC ATGGAGAAACAGGCTTAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 20} {0: 1, 1: 1, 2: 7, 3: 66, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!