ID: 1138497245_1138497250

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1138497245 1138497250
Species Human (GRCh38) Human (GRCh38)
Location 16:57416086-57416108 16:57416109-57416131
Sequence CCACAGCGCAAGATGCGCTTCCA CTCCGGCCTGTCACTCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47} {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!