ID: 1138499030_1138499039

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1138499030 1138499039
Species Human (GRCh38) Human (GRCh38)
Location 16:57427194-57427216 16:57427228-57427250
Sequence CCAGGAGTCCTGGCACAGAAGAC CTCAGGATCTTACAAGGTGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!