ID: 1138505563_1138505572

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1138505563 1138505572
Species Human (GRCh38) Human (GRCh38)
Location 16:57476663-57476685 16:57476686-57476708
Sequence CCCTGCTCCAGCTGGGAACCCAA AGCTGTTTGAGGTAAAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 181} {0: 1, 1: 0, 2: 0, 3: 16, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!