ID: 1138528092_1138528097

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1138528092 1138528097
Species Human (GRCh38) Human (GRCh38)
Location 16:57620348-57620370 16:57620373-57620395
Sequence CCGGGCATGCTGGCATGGTGGTC CCTAGCACCGGGAAGCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 241} {0: 1, 1: 0, 2: 1, 3: 14, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!