ID: 1138541229_1138541241

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1138541229 1138541241
Species Human (GRCh38) Human (GRCh38)
Location 16:57688969-57688991 16:57689014-57689036
Sequence CCCCTGGTCTCTGCCCATCCAAT GACCCCCGTGTTCAGAGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 258} {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!