ID: 1138546654_1138546663

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1138546654 1138546663
Species Human (GRCh38) Human (GRCh38)
Location 16:57723432-57723454 16:57723474-57723496
Sequence CCACATTTAAAGGAGGCAGTGCC TGTAATCCAAGCGCTTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154} {0: 17, 1: 5002, 2: 323478, 3: 273215, 4: 203630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!