|
Left Crispr |
Right Crispr |
| Crispr ID |
1138564010 |
1138564015 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:57819325-57819347
|
16:57819352-57819374
|
| Sequence |
CCAGGCACAGTATCATGTGCCTG |
GCTAGCTACCTGGGAGGCTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 14, 2: 127, 3: 970, 4: 6820} |
{0: 4, 1: 371, 2: 10511, 3: 117520, 4: 226040} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|