ID: 1138574629_1138574638

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1138574629 1138574638
Species Human (GRCh38) Human (GRCh38)
Location 16:57899789-57899811 16:57899839-57899861
Sequence CCTCCATGTTTCTGTTTAGTTTG CACCTCAGTAACCAGTCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 416} {0: 1, 1: 0, 2: 0, 3: 17, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!