ID: 1138583218_1138583225

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1138583218 1138583225
Species Human (GRCh38) Human (GRCh38)
Location 16:57955060-57955082 16:57955100-57955122
Sequence CCACAGCCCTCTGGGGGTAAGTC TCTTGCAGGCTGCCCATGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 157} {0: 1, 1: 0, 2: 2, 3: 17, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!